Molecular Basis of Inheritance

NCERT Exercise

Question 1: Group the following as nitrogenous bases and nucleosides: Adenine, Cytidine, Thymine, Guanosine, Uracil and Cytosine.

Answer: Nitrogenous Bases; Adenine, Thymine and Uracil

Nucleosides: Cytidine, Guanosine and Cytosine

Question 2: If a double stranded DNA has 20 per cent of cytosine, calculate the per cent of adenine in the DNA.

Answer: Percentage of cytosine = 20% (given)
Percentage of Guanine = Percentage of Cytosine = 20%
Hence, percentage of Thymine + Adenine = 100 – (20 + 20) = 60%
As percentage of Thymine = Percentage of Adenine
Hence, percentage of Adenine = 60/2 = 30%

Question 3: If the sequence of one strand of DNA is written as follows:
5'-ATGCATGCATGCATGCATGCATGCATGC-3'
Write down the sequence of complementary strand in 5' → 3' direction.

Answer: Sequence of complementary strand in 5’ → 3’ direction:
5’ – TACGTACGTACGTACGTACGTACGTACG- 3’

Question 4: If the sequence of the coding strand in a transcription unit is written as follows: 5 ' -ATGCATGCATGCATGCATGCATGCATGC-3 ' Write down the sequence of mRNA.

Answer: 5’ - AUGCAUGCAUGCAUGCAUGCAUGCAUGC – 3’

Question 5: Which property of DNA double helix led Watson and Crick to hypothesise semi-conservative mode of DNA replication? Explain.

Answer: The two strands of DNA separate and act as a template for the synthesis of new complementary strands. After the completion of replication, each DNA molecule has one parental and one newly synthesised strand. This scheme was termed as semiconservative DNA replication. The complementarity of bases led Watson and Crick to hypothesise semi-conservative mode of DNA replication.

Question 6: Depending upon the chemical nature of the template (DNA or RNA) and the nature of nucleic acids synthesised from it (DNA or RNA), list the types of nucleic acid polymerases.

Answer: Following are the nucleic acid polymerases:

The RNA polymerase I transcribes rRNAs (28S, 18S, and 5.8S).
The RNA polymerase III is responsible for transcription of tRNA, 5srRNA, and snRNAs (small nuclear RNAs).
The RNA polymerase II transcribes precursor of mRNA, the heterogeneous nuclear RNA (hnRNA).

Question 7: How did Hershey and Chase differentiate between DNA and protein in their experiment while proving that DNA is the genetic material?

Answer: Bacteria which were infected with viruses that had radioactive DNA were radioactive. This indicated that DNA was the material that passed from the virus to the bacteria. Bacteria which were infected with viruses that had radioactive proteins were not radioactive. This indicated that proteins did not enter the bacteria from the viruses. This proved that it is the DNA that was passed from virus to bacteria. This proved that DNA is the genetic material.

Question 8: Differentiate between the followings:

(a) Repetitive DNA and Satellite DNA

Answer:

Repetitive DNA	Satellite DNA
It is the non-coding DNA with repeat sequences. The sequences may lie in tandem or interspersed.	It is the non-coding DNA with repeat sequence which lie in tandem.
They can be from a few base pairs to hundreds or thousands of base pairs.	They are generally short sequence repeats (up to 60 base pairs).
It appears as light band.	It appears as small dark band.

(b) mRNA and tRNA

Answer:

mRNA	tRNA
It is called messenger RNA.	It is called transfer RNA.
It carries the code for amino acid sequence.	It carries amino acids to the site of protein synthesis.
It is a linear molecule.	It is clover leaf shaped molecule.
It is synthesized by RNA polymerase II	It is synthesized by RNA polymerase III.

Answer:

Template Strand	Coding Strand
This strand is transcribed into RNA.	It has the same sequence as mRNA.
It has 3’ → 5’ polarity.	It has 5’ → 3’ polarity.

Question 9: List two essential roles of ribosome during translation.

Answer: Role of ribosome during translation:

Ribosome binds to mRNA and provides a platform for joining of amino acids.
Ribosome acts as a catalyst for the formation of a peptide bond.

Question 10: In the medium where E. coli was growing, lactose was added, which induced the lac operon. Then, why does lac operon shut down some time after addition of lactose in the medium?

Answer: If lactose is provided in the growth medium of the bacteria, the lactose is transported into the cells through the action of permease. The lactose then induces the operon in the following manner.

The repressor of the operon is synthesised (all-the-time – constitutively) from the i gene. The repressor protein binds to the operator region of the operon and prevents RNA polymerase from transcribing the operon. Thus, addition of lactose in culture medium shuts down lac operon.

Question 11: Explain (in one or two lines) the function of the followings:

(a) Promoter

Answer: This is a region of DNA that helps in initiating transcription. It serves as binding site for RNA polymerase.

(b) tRNA

Answer: It carries specific amino acid to mRNA during translation of protein.

Answer: The coding sequences of DNA that are transcribed and translated are called exons.

Question 12: Why is the Human Genome project called a mega project?

Answer: The Human Genome Project is called a mega project due to following reasons:

Number of base pairs to be sequenced was huge.
The project involved a huge monetary cost.
Many countries participated in the project.
Powerful computers were needed to compile and analyse the data.

Question 13: What is DNA fingerprinting? Mention its application.

Answer: The technique to identify and analyse the variations among individuals at the level of DNA is called DNA fingerprinting. Following are the applications of DNA fingerprinting.

To identify a crime suspect.
To settle parental disputes.
To identify and protect important crops.
To find the evolutionary history of an organism.

Question 14: Briefly describe the following:

(a) Transcription

Answer: The process of copying genetic information from a strand of DNA into RNA is called transcription. During transcription only a segment of DNA and only one strand is copied into RNA.

(b) Polymorphism

Answer: Allelic sequence variation has traditionally been described as a DNA polymorphism if more than one variant (allele) at a locus occurs in human population with a frequency greater than 0.01. In simple terms, if an inheritable mutation is observed in a population at high frequency, it is referred to as DNA polymorphism

Answer: The process of polymerization of amino acids to form a polypeptide is called translation. Translation takes place in cytoplasm.

(d) Bioinformatics

Answer: Application of computer science and IT for storage, processing and analyzing information on genetics is called bioinformatics.